Bioinformatics Fun Challenges

Hi everyone!

To make our community more lively (and to have some fun!), we’re starting a series of light mini-challenges about bioinformatics. No experience required — each challenge is small, friendly, and meant to spark curiosity.

Everyone is welcome to join at any time. Let’s learn together, share solutions, and enjoy the process!

Quiz 1: “The Encoded Message”

A few days ago, one of our staff at IGF found a mysterious tube with a note slipped under the office door. It just says, “sequence me!

Curious, the team decided to sequence it with the Single Amplicon Sequencing on the IGF PromethION system.

After basecalling, the sequence was returned: ATGTCTGCTATGCCGGAACTGGCTATGGCTAACTAA

It wasn’t any known barcode or conserved region.
But something felt intentional.
The codons looked too neat.
The open reading frame looked too clean.
It seemed like someone had hidden a message inside the DNA.

Your mission, should you choose to accept it:
Decode the message hidden in the DNA.

Met-Ser-Ala-Met-Pro-Glu-Leu-Ala-Met-Ala-Asn

Thus:

(M)SampelAman